Transkription & Translation von 3 DNS Strängen

Dieses Thema im Forum "Schule, Studium, Ausbildung" wurde erstellt von Peacekeeper, 11. Dezember 2008 .

Schlagworte:
  1. Diese Seite verwendet Cookies. Wenn du dich weiterhin auf dieser Seite aufhältst, akzeptierst du unseren Einsatz von Cookies. Weitere Informationen
  1. #1 11. Dezember 2008
    Ich blick nur des hier ned so ganz

    Wie soll ich die richtig transkribieren etc ....
    Hier ist das Schema nach dem es gemacht werden soll *KLICK*


    TTCCATACTATGGGACCACTCTCATC

    ATACCCCTTTATACGCGCGATTTTAGAGTAG

    TAATCGTCATGAAGAAATCAAGCTCTTAG


    Evtl noch eine Auflistung der enstandenen Aminosäuren, aber nich zwingend
    Wäre nice, brauch das jetz in 10 Minuten wenns geht thx schonma BW is sure
     

  2. Anzeige
  3. #2 11. Dezember 2008
    AW: SCHNELL Transkription & Translation von 3 DNS Strängen

    TTCCATACTATGGGACCACTCTCATC <--original
    AAGGUAUGAUACCCUGGUGAGAGUAG <--transkribiert

    ATACCCCTTTATACGCGCGATTTTAGAGTAG <--original
    UAUGGGGAAAUAUGCGCGCUAAAAUCUCAUC <--transkribiert

    TAATCGTCATGAAGAAATCAAGCTCTTAG <--original
    AUUAGCAGUACUUCUUUAGUUCGAGAAUC <--transkribiert
     
  4. #3 11. Dezember 2008
    AW: SCHNELL Transkription & Translation von 3 DNS Strängen

    da schreibe ich morgen ne klausur drüber :D

    also es ist nicht wirklich schwer..

    für thymin kommt adenien
    für guanin kommt cytosin und umgekehrt
    für adenin kommt uracil

    T -> A
    A -> U
    G -> C
    C -> G

    worauf du dann bei der angabe der aminosäuren achten musst, ist, wenn du auf dein stop codon wie UAG oder UAA triffst ist das ding auch zuende.
     
  5. #4 11. Dezember 2008
    AW: SCHNELL Transkription & Translation von 3 DNS Strängen

    Oh du bist klasse danke

    Aber jetzt komme ich bei dem dritten Strang durcheinander, entweder die Transkription ist inkorrekt
    ODer der Strang weist kein Startcodon auf, kann insofern nicht übersetzt werden ... oO ?????

    Bw is schonma raus

    Edit, oh danke auch für deinen Beitrag --- ich schreibe morgen auch .. in den ersten beiden Stunden xD
    Bw haste auch ...
     
  6. #5 11. Dezember 2008
    AW: SCHNELL Transkription & Translation von 3 DNS Strängen

    sind wir zufällig in der gleichen klasse? ich schreibe ebenfalls in den ersten beiden stunden :D
    meine lehrerin heißt fr. voß ;P



    umh, das habe ich jetzt auch nicht verstanden. wo sind denn in der transkription jetzt die start codons? ^^
     
  7. #6 11. Dezember 2008
    AW: SCHNELL Transkription & Translation von 3 DNS Strängen

    Ne, du bist nicht auf meiner Schule ^^
    Aber schon ein lustiger Zufall :D

    Kleiner Tipp - bevor du pennen gehst mach das QUIZ
     

  8. Videos zum Thema
Die Seite wird geladen...
Similar Threads - Transkription Translation DNS
  1. Antworten:
    4
    Aufrufe:
    357
  2. Antworten:
    0
    Aufrufe:
    281
  3. Translationparty

    Moepix , 5. September 2009 , im Forum: Humor & Fun
    Antworten:
    39
    Aufrufe:
    1.347
  4. Antworten:
    5
    Aufrufe:
    386
  5. Antworten:
    0
    Aufrufe:
    280